METABLE2 Genes

PROKKA_00070 Marinomonas

GenomeMarinomonas ctg_1:63588-64403
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00070 hypothetical protein
ATGGTGCAGCATTTTGCTGATAATCTGCAGTTGTTATGTAGTTACTACAAATCGGTGGCG
GATGTATGTCGTCGACTAAATATCAATCGTGCTCAATTTAATCGTTACTTAAATGGGACG
ACGGTGCCGAGTAGTAGTACTCGGCGTCGTATAGGAGAGTTTTTTGGTGTTGAGCCTAGT
GAGATGGCGTTGCCACACGATCAATTTGTTAAATTGGTTCAAGCACGACCTATTCGTCAG
AGTGAGGACGTAAAAAGTCTTACGCCTGAGCAGCAGCAATTTAATCAGCTGAATCAATCT
GGACAGCATGGTTTAGCTAAGTACTCTGGTTATTACTTTGAATATTATCTTTCCATGGCG
TGCCCAGGAAAAATTTTACGCACCTTGGTTCATATAGAGTCTCAAGGTGACAAAACTTAC
TATCAGCGTACTGAGCGTCTGAATCCTCGTAATTTAAAAAAATCTTTTCATGGTATTTAT
AATGGTGTGGTGCAGCTCTTATCGGATCGATTATTTTTAATTGATTATGAACGTCAGACT
CATGTTGAGATGACGCAGACGATTCTTTATCCTTCTTTTCAAAATCGTGTCGAGCGATTA
ACTGGATTGCGTTTAGGTGTATCAGGAAGCGGTGAAAGAGCACCATGTTGCGCTCGAGTT
GTCTATGAGTACTTAGGTTTGAATATCAATAAAAAGCGTGCAGTTGCTCAATGTGGATTG
TATGACGTAGACAGTGATCTGATAGATGAGGATATTTGCCAGTCAATCAAAAATGATATG
AAAGAAGGTGACTGGCATTTTAGAGCGAGATTTTAA