METABLE2 Genes

PROKKA_00074 Marinomonas

GenomeMarinomonas ctg_1:68658-69011
ProductCDS Glyoxalase-like domain protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF12681.1
Sequence
>PROKKA_00074 Glyoxalase-like domain protein
ATGGAATCCAATAAGATCAATTATGTTGAATTACCAGCGCGTGATTTGGCGTTAAATAAA
GCCTTTTTTAGTCAAGTGTTTGGTTGGGGGTTTAGAGATTACGGCCCAGAATATTCAGCG
TTTGAAAATGCAGGATTAGATGGAGGCTTTTTTCAAGCGAACTTTTGTTCAAGACCACAA
AATGGCGCGGCGTTGATTATTCTGTATAGTAATGAACTTGAAGTCGTATTTGAAAAAGTA
CAAGCGGCGGGTGGAACGATTGAACAAGTAATTTTTGACTTCCCTGGTGGTCGTCGTTTT
CACTTTCTAGATCCGTGTGGTAACGAATGGGCGGTGTGGAGTGAGCCTGCTTAA