METABLE2 Genes

PROKKA_00075 Marinomonas

GenomeMarinomonas ctg_1:69019-69906
ProductCDS EamA-like transporter family protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF00892.14
Sequence
>PROKKA_00075 EamA-like transporter family protein
ATGTGGATCTTTATTACTCTGTTTGCAGCAGGTTGTCAGTCGGTTCGAACGGCGTATCAA
AATACTCTGGCTCGTGAAACTGGGTTTTTACATGCCACTATGTCGCGTTCTTTATATGGC
TTGCCATTAGTCAGTGTGTATCTTGTTATTTGTTGGCAGCTATTTGGTTGGGTATCTGTC
GAAAAAAATCTAGTTTTTGTCATCGCGGCAAGCATTTGTGCCATTACTCAGATTATGGCG
ACGTATTTTATGTTGCGAGCCTTTCAGGCTGGTAGTTTCGCATTGGGAACCTTGTTGTCT
AAAACAGAAGCGGTTTTGGCTGCGTTAATTGGTTTGCCTCTACTGCATTATACTTTGACC
ATGGGAGCGTGGTTTGGCATTGCTTTTGGTGTGTTAGGGGCTATTGTAATGAGTGTTAAG
TGGAACAATATTAGACAAGCGCACAAGGACGTATCTCTTTTACTTGGGCTTGCTAGTGGT
TTGTGTTTTGCTATTACCTCGGTAACATCGTCTATCGCCAGTCATTCTTTATCTGGTTCT
CTGATTACTAGTGCAGGCGTCACGCTTTGGTATGTTTTAGCTTTGCAATCTATTATTTTG
TGTGGCATTCAGATTTATAAAAGCAAAGATATTTTAGCTCCGTTTAAGCATGAATTTGCG
TTAAGTTGTAAGGTAGGTGTCTTAAGTTCTCTAGGGTCAATTGGTTGGTTTACTGGTTTT
GCTTTGGTTAATCCAGCTTTGGTGAAAACGTTAGGGCAGATTGAAATAATCGGAACCTTG
TATTATTCAAAAGTTCGTTTTTCTGAAAAAATGACGACGCAGCAATGGATTGGTGGCGCA
ATGATTGTGATCAGCGTTATCTTAGTAGTGACATCGACGATTAAGTGA