METABLE2 Genes

PROKKA_00076 Marinomonas

GenomeMarinomonas ctg_1:70008-71066
ProductCDS Nitronate monooxygenase
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:Q9I4V0
Sequence
>PROKKA_00076 Nitronate monooxygenase
ATGAAACAATTTCGTTCATGTGATTGGTTGGGAATGGACTATCCGATTATTCAGGCACCT
ATGGCAGGCGTTCAAGACAGTGCTTTGGCTATTGTGGTCTCGGAAGCGGGTGGTTTGGGG
TCTTTGCCATGCGCTATGCTAAGCGTGGATGATATTGCTCATCAGGTTTCCTTAATTAAA
GCCTCGACGAATAAACCGTATAATCTGAATTTTTTCTGTCATGACACTTCAGAATACAAT
GAAATAAAGCATCAACAATGGCTAGCGTTGTTGAAACCGTATTTTGATAAGCTTTCAGGT
CAATATGATGCGACCATAAAAGCCGCAACCCGAATGCCTTTCAGTCACGATATTGCCGAT
GTGATAGAAGACTTTGCTCCCCCCGTTATTAGTTTTCACTTTGGTTTGCCTGACGCTAAG
TTGCTTGCACGGGTTAAAAGTTGGGGAACTAAGGTACTGTCTTCTGCGACAACACTTGAA
GAAGCGGTTTGGTTAGAAGAAAATGGCGTGGATGGCATCATTGCGCAAGGTCTTGAGGCG
GGAGGGCATCGAGGGATGTTTCTGTCGAAAGATGTTTCTACTCAAATTGGTTTGTTTTCA
CTATTGCCTCAAATTGTCGATCGAGTAAGTGTCCCTGTGATTGCAGCAGGCGGTATTTGT
GATGCTCGTAGTATTAACTGCGCTTTGTCTCTGGGTGCGTCAGTAGTACAGATAGGGACT
TCCTATTTGTTGTGTCACGAAGCTAAAACATCTCAACTTCATCGTGCTGCTTTAAAAAGT
CAAAGAGCCCATCATACGGCTTTAACCAATGTTTTTACTGGGCGACCTGCACGAGGTATT
GCTAATCGTATTATGAAAGATCTTGGCTATATGAATTCCAGTGTGCCAGATTTTCCTTAT
GCATCAATGGAAATGGCGCAATTGAAAAATTTGGCAGAGAAGCAGAATTTGGATGATTTT
TCTTCTTTGTGGAGTGGGCAGAATGTGTCAGGTTGCCAAGAAATATCCGCTTTTGATTTG
ACCAAACAATTCGCTGAGGCCTGTCGAATTGTTTCCTAA