METABLE2 Genes

PROKKA_00078 Marinomonas

GenomeMarinomonas ctg_1:71702-72142
ProductCDS GtrA-like protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF04138.8
Sequence
>PROKKA_00078 GtrA-like protein
ATGAACTTAATTTTCAAACATACTTTTGTACGCTTTGCTATCGTCGGTGGTGCTGGCTTT
CTAGTCGACCTTGCCAGTATGCTGCTGCTTTCCATTTGGTTGCCGCATCTTGTTGCTCGT
GGTTTCGCATTTTGGGTCGCAGCCAGCTCGAACTGGTGGTGGAATCGCACTATTACTTTT
ACTGACCCCAAACAAGAAAAAAAAAGCGACAGCAAAAAGGCTGCCGCTCTGCAATGGATG
CAATTTCTTGGCAGCTCTGTTATTGCCTTTGTGCCTAATTGGGGTTGCTATCTAATATTA
ATATCTCAACCACCAGCAACATCCAATTCTACACTGACTCTTTTATGGCCTTATTTAGCC
ATGATACCCGGCATATTAATTGGCATGATGCTCAATTATGTTTTCTCACGCTATTGGGTG
TTTTCTCCCGCTAAGCTTTAA