METABLE2 Genes

PROKKA_00082 Marinomonas

GenomeMarinomonas ctg_1:75411-76436
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:P77293
Sequence
>PROKKA_00082 hypothetical protein
ATGAGCGCCATTCCATATAGACAATACGCGAACTTTGAATCCGCGGCAAAGGAGCCTACA
GTAAAGGCGCAGCCTCTCGTATCAGTAATCATTCCATTCCTAAATGAAGCGGATGTATTG
GCAGTTTGCCATCGACGTGTCTGTGAAGCGCTTTCTAAACTCCAACAGTATTGTGAAATC
ATCTACATCGATGATGGCAGTAATGACAACAGCTGGAAAATGGTGAGTCAGTTCAAACAC
CCCTTACATCAAATACGCAGCTTAAGATTAAGCAGAAATTTCGGTAAAGAAGCCGCAATG
AGCGCAGGCATGAAAGCAGCCTCAGGCCGCTGTGTCATTCTACTTGATGCGGATTTACAA
GATCCACCAGAATACATTCCCGATATGGTACAAGCGTGGCAAGATGGCGTACAAGTCGTC
GAAATGCAACGCCGCGAGCGCCATGGAGAGAGCTGGGTAAAACGCACCACCGCACATTGC
TTCTATCGTTTTATGTCCAAAATAAGCGATCACCCAATTACCGAAAACGTCGGTGATTTT
CGTTTGATGGATCAAAAAGTCGTAAACGTTATTAACACTTTGCCAGAAAGGACCCGCTTT
ATGAAAGGTTTACTTGCTTGGCCTGGTTTTACTCGTAAAGTCCTCACCTTTGACCGCGAC
CCTCGTTTGGCCGGTGACACCAAGTGGAATTACCCAAAGCTGATTCATTTGGCATTGGAA
GGCATTACCTCATTCAGCACAAAACCATTACGCTGGGCGACTATGGCAGGATTAACCACA
TCGGCTATCGCCTTTATTATGGCTCTGATTATTTTCACCAAAACCATCGTCTGGGGTGAT
CCAGTTGCAGGTTATCCATCGACAATACTCGTAGTTTTATTTTTAGGTGGTATTCAGCTT
TTATCCATTGGTGTACTAGGCGAGTACGTTGGACGGTTGTTTATTGAGTCCAAACAACGA
CCGTTGTATGTACTCATGGAAGACGCTATGACAAAACCCACGTTCAAATACTCGGACTCT
GAATAA