METABLE2 Genes

PROKKA_00092 Marinomonas

GenomeMarinomonas ctg_1:86483-87445
ProductCDS NMT1/THI5 like protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF09084.5
Sequence
>PROKKA_00092 NMT1/THI5 like protein
ATGAAAAAATCACTATTAGCAGTTCTTACTACTTGCTCAATCACGCTGCTATCAGCCAAT
ACCTCTGCACAAATTTTGTCTATTGCGTCACCGCCACAAGGTTCTGTTTGGAACACGATG
AGTAATGGCATAGCCAATGTAGGCAGATCCAAAGAAAACATTAATTTAGTGGTTCAGCCC
TATAGCGGCAACCGCGCCATGATGGATGCGGTAAATCAAGGCTTGGCCGAGTTTGCCATT
AATGATGTAAACGATGCCATAGTGGCTGCCCAAGGCGAAGCAGATTACAAGGGTAAAAAA
CGCGACCACTTAAGAATTGCCCTACGAATCAGCCCTCAACCTATTGGCATTTTTGTCCGT
AAAGACGCGGGCATAAATACGATTGCAGATTTAAAAGGTAAACGCGTTGCATCAGGTTGG
AATGCTTTTCCAATTGGTCGTCCTCACATGGAGGCCATGTTGGCAACTGGCGGCTTAACT
TGGGACGATGTTCAACAAGTTCCTGTTCCTGACTTAATTCGTGCTGCTGACAATCTTTCC
GCCAATCGTTTAGATGCAACTTATTTTGCTGTAGGTGGACCCAAAGTGGCGGAAGTTGAT
GCGTCTGTTGGTGGCGTCACCTTTCTTCCTGTCAACGCGGATCAAGCGGCGCTCGACGCA
GTACTAAAAATACGCCCTGCTTTTTATTTTTCAGAAATTAAACCTGCACCGCATCTAGTT
GGCATCGACAAAACCATAAACATGCTGACATGGGATAACGTCTTAGTCGTCAATGACAAA
GTCTCTGATGAGCAAGTCTACCAAATGGTAAAAGCCATTTTGGAAAACAAAGACGCCTTG
GTACAGCTTTACCCAGGCTTTAAAACATTAGCTATTAATACACCAAACAAAAACTATCCC
GGAATTCAATACCACCCAGGTGCGATTCGTTACTTCAAAGAAAAAGGCCTTTGGCAGGAG
TAA