METABLE2 Genes

PROKKA_00093 Marinomonas

GenomeMarinomonas ctg_1:87501-89444
ProductCDS DctM-like transporters
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF06808.6
Sequence
>PROKKA_00093 DctM-like transporters
ATGAACACGGAATCATCAACTCAAGAAGTTGTTATTCACGAGCCTGCGATGATATCAGTA
TTAAGAAATGGCTTAGGGGTGTTAATCGCCCTCGCCGCCATTGCTTTTGCCGCTGATCTT
TTCAGCCGCTTAGGAATTGCAATTTATACTGAACAATATCTAGCGGTGATCTTGGGGATC
AGCTTAGCGCTGGTCTTTCTAAAACCCCAAAGTAGCCAATTAAAACGCAGCCTAAATGGT
CTGCTTGCGCTACTCGGTTTGATCACCAGTCTATATTTAGCAGTGCAATATCCTGATCTT
GTTGAGCGACAACTCGATCTTCCTTTAGATGCCTTAGCAATTTCCGCCATACTATTTGTT
CTGGTATTGGAAGGATTAAGACGAGTAGTTGGGCTCACCTTAGTCATTGTCGTCATGCTA
TTTATGGTATTCGCCCTACTAGGCAGCCATCTTTCAGGCCCTCTACAAACACGTGACATT
GACCTAGATAGACTCTTCGTTTATCTCGGTGTCGATACTAACGGTATGTTAGGGTTAACC
CTTAACGTAGCGGCCACCATTGTTATTGGCTTTATTTTATTCGGGCAGCTGCTACTTCGT
TCTGGTGGAGCTGACTTTTTCAATGATATTGCTTTAGCTCTAATGGGTCGAAGCAAAGGT
GGTTCAGGCAAAATCGCCACTATCGCTTCAGCGTTATTTGGCTCCATTTCCGGCGTCGTT
GTATCGAATATTGTGGCTACAGGTGTCGTCACTATTCGTATGATGAAAAAAGGTGGATTC
AAACCTCACACGGCAGCCGCCATTGAAACTGTTGCATCAACGGGTGGGCAAATTATGCCT
CCTGTAATGGGTGCTGTGGCTTTCTTGATGGCAGAATTCCTGCAAATTGGTTATAGCGAG
GTGGTCATTGCCGCTTTGGTACCTGCCATTCTTTACTATGCAGCACTGTATATCCAAGTT
GATTTAGAAGCGGCAAAAGAACAAATCAAACCGATTGATCCTGCACTTATTCCCTCTAAA
AGAAAGGTTCTACAACAAGGTTGGATTTTTATCATTCCTTTCGCTGCCGTAATTTTAGCC
CTCTTTAGCTTTAACCAACGTCCGGAAACGGCCGCCCTTTGGGGTGCTCTTGGTGCACTA
ATTGTTGGTGTATTAAAAGGTTATAAGGGCAAACGCATGGGCGCTAAAGACATCTTGGGC
AGCCTAGAGGAAACTGGGCATTCTATTGTCGATATCATCATGATTGGTGCCGCTGCAGGG
TTCATTATCGGCATACTAAATATCACCGGCTTAGGCTTCGGATTAACCTATTTCTTGGTC
GAATTAGGCCAAGGCAATCTATTCCTCTTACTGGTCATTTCTGCTGTGGTTTGCATCGTA
CTCGGTATGGGAATGCCAACCGTCGGCGTGTATTTATTGCTCGCTGTTTTAGTCGCGCCC
TCATTAATTCAAGTTGGTGTAGAACCTATTGCAGCACATCTGTTCATCTTCTATCTGGGC
ATGATGTCCATGGTGACACCGCCGATAGCCATTGGCGCCTTCTTTGCTGCCAGCATTGCC
AAGGCAAATCCAATGAAAACAGCATTGACCTCAATGAGACTCGGTTGGACGGCATACATT
ATCCCATTCTTGTTTGTCACAACGCCGTCACTCTTATTAATCGGAGAGACATCACAAATT
GTCATTACAGTGATGAGCGCACTGATCGGTGTTTGGGCTGTATCGGTAGGCTTTGCGGGT
TACTTCAAAAATAAACTAAACCTCGTATTTCGATTTGGTTTTGTCATCGCGGGAGGCTTA
TTTTTACTGCCAAATTTACAAGGCGGTGATACGCCAATTGCTCCAAAGGTGGCAGGTCTG
GCTCTATTAGCTACTCTACTTTGCGCAACTCTTCTCGTTAATAAAGCAACGTCTCAGGCG
TCATCTAAACAGACTCAATCTTAG