METABLE2 Genes

PROKKA_00099 Marinomonas

GenomeMarinomonas ctg_1:94554-94796
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00099 hypothetical protein
ATGAAAAACTGCACATCAGAAGAATTAAACAACCTCGAAAACAACCAACTAGACATAACC
TCTAACTGCAAAAACGCATTAGCTAAACTAGAAGCAAACACATGGAAACAACGCCTAGCC
AAAATAGCCCACAACTGGCGTACAAGAAGCAGATTGAGCCAACTTAACGACGCTCAACTA
AAAGACCTCGGCCTAACCGCCGCCGACGTGGATCAAGAAGTGAGAAAGCCGGTTTGGAAG
TGA