METABLE2 Genes

PROKKA_00100 Marinomonas

GenomeMarinomonas ctg_1:95104-96966
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00100 hypothetical protein
GTGAAAAAGGATGAGAAGGTAAAACTATCAAATATACTGTCTACAGTTAATCAAGTTGAA
AAATCAAAGTTTATAAATTTTTTAGATCGTGTTTGTAGCGAAGCAATTACACACGATAAA
GAACTGGCAAAACGAGTCAACAATATTGACGGACAAATAAAAAATGCCTCCAGTGGCGAG
ATCATTCAACTCTTTGAGTTAGTTCTTCCTTACTTTGAAAAAAGTGTTAAAGAACAGTTA
GCTATGCTTGGAGCACAAGCATCTTTGCTTATCAATATAGTCAGCCGAGATGGAAACTGC
ATTGCACGCCTATCATGGATTGAAGCTCTCTACACCAAAGAATGGACCTCCATAGATTCT
AAGGCTAAGGAAATAAATAGTTTAATAGAAGCTTCGCTCGATAATGAGGAATTTAATGAA
GCTAAGCGTTTAGAAATCTATTATTCATGCCTTAAAGAGGCATACACTAATGATGAGAGG
AACAATAGAGAAGCCAAAATCACAGATGATGAAAGAAGCATTTTAAATGTCTTAGCTAAC
AAACTGGACATTACAGCCGATCAGAAATCCGCAGTTGAGCATTTAGTCAATGCTATTCCT
CAAACAGGAGTCCAAGACTGCCTCAACACTTTACGAGAAGTCGGACTTGTTTTTGTAAGC
CGAAAAAACCTAACCGTTTACATTGCCGATGAAATAGTCGCAATGCTCAACCGAATGCAA
GGTAAAGAATTGGCGGATAAACATTTACTACGCATATTACGCACTCTAAGCGACTCTGAG
CTATCAAATATTCTCAAAGCCCATGGCAAACGTATCAGAGGCAAGGAACGAAAAGAAAAA
ATCAGTGAAATCATTAAAATGGGCTTACCGATATCCCTAGTACTACAACAAGACATCAAC
AACCCTGACGCAAATATTAACGATCGTAAAGAGCGTTTAAAAGTACTCATTTCTGACCTA
GATTTAGGTTTAGATAAAATAGGTACAACACTTGATGAAAGAACAGATTTAATTATCTCA
TCTCTAAACTCCTCTACAGAAAATGAATTCAATGCACTCAGTGCTACTGGCTTTAAAGAT
CTATTTTCCACCTTAAAAACCCACTTCCCAACACTAACATCAGTCCTACACCAAGATTTT
GAAATTGAAGATAATGAGGAACTAGATGTCGATAAACTTAGAGCATTGAGCATCACTCCT
CACGATATTCTTTACATGCTGTCCAATGAAGATATTAAATCTGTTCGCGACAGTATGGGG
GTGAGCAAGCGGGGAAATCCACGCTTAGTCATTTTGGAGAGCTTTGCCGATGCTACAGAT
AAGCTAATTGAAAACTACGCATTGTTAGCAAAAAGGGATCTTGCAGGTTTAAAAAATGAG
GGAATAGAAATCACAGAAGCCGATATTGGCATTAAGTTCGAGGAGGTAACTAAAGCCATC
TTCGAACAACTTGGCCTTGATGTAGATGAAGATTTAAGAAGATCTATCAATACAGCAAAA
GATAAAGCAGATATTATTCTTTCACTGAGCGAAGACGATATAATCATCGGCGAAGCTAAA
ACCTGTAAGAATGGGGATTTCGCTAAATACTCAACAACTTCGCGCCAAGTTAAAGCTTAT
GTTAATCGTTGCGAATCTTCAGGAAAGCGTGTGGCTCAAGTATTAATCATCGCTCCATCA
TTTTCTACCGACTTTGTTGAATCAGCCGAAATGGATACAGAGATTAATATATCCTTATTA
GAAGCTGCTGGACTTAAGCAGATATTAGATGCATTTAAATCTAGAAGAAATCCGAATTTT
TCTGCAAAACTCTTTACAAAGGGTGGTCTGTTAAAAGCAGACCTAATTGCTAAGAATGTT
TAA