METABLE2 Genes

PROKKA_00101 Marinomonas

GenomeMarinomonas ctg_1:97023-97502
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00101 hypothetical protein
ATGCACATAAATGAACTAACATCTTCCCCTTTTAAAGAAGCTGAATTAGACAATATTTTA
AGTTTAACGGAAGAAAATGAATATCACTTATCTCAATGGAGGCTAACCTCTAAACATCGA
GAAAAATTTAAGTGGAGCGCAATCATTAGCTCATTAGCAGTTAGTCAAGCTATATATATG
AAGGATGCTTCAATAATAGCTCATGTATTTAATTTGAAATTTGGTATTGTTGCTGGATTT
ATTTTGATTTTTTATTCATTTTTTCAATGGTATACCCTCAGAAAAAACGCGTCAGAAAGC
TATGAACTCGCAAATAAAATACAACGAGATACTGAAGAGAAATATGGTGTACGTCTCATT
ACTGCGAATTGCGTGGTTGTAGATAGCGATAAATATAGCTATTTCATCAGGCTGCCATCT
TTCGAAATTTACAATCGTACAGAGCGAAAGAAGGGGGATTTAGAGTCAGATGAAAAATAG