METABLE2 Genes

PROKKA_00102 Marinomonas

GenomeMarinomonas ctg_1:97976-98236
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00102 hypothetical protein
GTGTCGAGTGATGGTTTCGGCTTGCTCGCATCTCCAACGGAAGTCATACAAAGAAAGCTT
CGCTTTCGCGGCAGATTACGCTCCGCTTATCGTGCCCTACGTTTGGAGATGACTTGCAGG
AAGCAAGGCGAACGCCAAGAGCGAGGTCTAACGGTAATGTTGAATATTAACATCGAGCGG
TGGTGTTTGCTTATGTTTCATTCTCTGTCAGTTCAAGCTGTCTCTCACTTCGCCAGACTC
GTATTAGCACAATCTCTTTAG