METABLE2 Genes

PROKKA_00103 Marinomonas

GenomeMarinomonas ctg_1:98166-98465
ProductCDS Plasmid stabilisation system protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF05016.8
Sequence
>PROKKA_00103 Plasmid stabilisation system protein
ATGGAATTACGCATCGCACAGTCTGCTCTTGAAGATTTACAAGCGATTCAGAAGTATTAC
CGAGAGGAGGGAGTGCCGCATATCGGTGAGGACTTCATCGCTACTATATTGAAGCGTTGT
GGCATGCTTCAAATTCACCCTGATGCAGGTCGAATTGTCCCTGAATTCAATATGGATCAT
ATTCGCGAATTAATTCACGCGCCATTTCGGGTTGTCTACCTCAGACAAGCTAAAGAGATT
GTGCTAATACGAGTCTGGCGAAGTGAGAGACAGCTTGAACTGACAGAGAATGAAACATAA