METABLE2 Genes

PROKKA_00104 Marinomonas

GenomeMarinomonas ctg_1:98466-98735
ProductCDS Phd_YefM
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF02604.13
Sequence
>PROKKA_00104 Phd_YefM
ATGCAGATTAAATTTTCCGAGGATGTTATTCCTCTATCAGACCTTAAGATCAATCCCGGA
AAGGTAGTTGGTCGAACACAGGAAACGCATCGCCCAATTTTGCTTACCAGTCGCGGCCGC
GGCGTTGCGGTGGTTCAGGGGCTTGAAGATTATGAGAAAACCGCAGAGGAATTGCGATTT
GTAAAAGCCGTGGCGCAGGGACTAATGGATGCTCGCGAAGGCAACACCGTATCCTTGGAG
GACGCCAAGAAAACCTTGGGAATCAAGTAA