METABLE2 Genes

PROKKA_00105 Marinomonas

GenomeMarinomonas ctg_1:98937-99170
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00105 hypothetical protein
ATGAGTAATTTATCAAAGCGTTCAATCGTTTATTTTGAACCAGACATCCTCAAAGCGTTA
AAAATGCGAGCAGCATCATCGGATGTTTCTGTTTCAGAGTTAATTGATGAAGCGGTTCGT
TTGCTTATTGGAGAAGACCAAGAAGACCTTGCTGCTATATCAGAACGAGTGAATGAGCCA
GAAGTGTCTTATAAAGACTTTCAGAGTGAATTAAAAATTATTGGCAAATTATAA