METABLE2 Genes

PROKKA_00111 Marinomonas

GenomeMarinomonas ctg_1:105102-105563
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00111 hypothetical protein
ATGACATCACCAAAAAATGGGCTGAAAGCCATCGCATTTATAGAGGCGCTAAAAGGCTTA
ATGTCTCTTATCGTAGGATTAGGAATCCATGTCTTAGCTGGCGAGAATTTACAAAAAATA
GCTGAATCCATCGTCTCTCACGCTCATCTAAATCCTGCGAGCCATTTTCCAAGTATTTTC
CTCCATGCTGCGAGTTCAATAACAGACAGCAATATGAGCCTGATTGCTTTGGGTGCCCTA
GCTTATTCTCTGGTTCGATTCGTTGAAGCCTATGGTTTATGGAAAGCGTTTGTTTGGACT
GAATGGTTTGCCTTGGTAAGTGGGGCAATCTATTTACCATTTGAGATCTATGAAATCATT
TTTCATACACACATTTTGACTGTCTGCGTATTTTTGCTAAATGTCGTAGTGGTTTGCTAC
ATGGCGAGTGTGCTTTACAGTAAACGAAAAAAAGACACATAA