METABLE2 Genes

PROKKA_00112 Marinomonas

GenomeMarinomonas ctg_1:105876-106871
ProductCDS Putative thiamine biosynthesis protein
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:P44658
Sequence
>PROKKA_00112 Putative thiamine biosynthesis protein
ATGAAAGCGGCAAAGAAAACAGCAATCCGATTGACTCTTTTGGCCAGTCTCATTTCAAGC
ACTTCTGCCATGGCGGCAGATCAAGTGACGTTTCAATTAGATTGGCTACCAGGCGGTGAT
AAAGCGCCTGTTTATGTGGGTATTCAACAAGGTTTCTTTGCTGATGAAGACTTGGAAGTC
AAGATTGCCAGCGGTCGTGGTTCTACCGATGCGTTGACTAAGATGGCAACGGGCCAATCT
GATATTGGTAGTTCCGATATTGGTGCTTTGATGGCAGCGAAAGCACAAGCCGATGTACCT
GTAGTCGCTGTCTTCCCATACTTCACACAAGCTCCTCATGCGTTCTTTGTGCTGAAAAGC
AGCGGTATTAAATCCATTAAAGATTTGAAAGGCAAAAAGGTCGCGACTTCGCCTTTCACT
TCATCAAATGCTTTCTTACCTTTGGTATTGAAACAAAATGGTTTGAGCGAAAACGATATT
AAATTAGTGAAATCGGATCCAGGTGCCTTGGCTCCGATGATGATTACCGGCAGTACAGAT
GCCATTATTGCTTGGGTTACCAACACGGCACTTTATGACGCACAAGCAAAAGGCGCAGGC
AAAGAGTTGATCGAAATGCCATGGTCGAATTCTGGTTTGTCACTTTATAGCTCATCTGTT
TTAGCCTCTGAACGTTTTTTAGAAGAACGTCCAGATGTGGCAAAACGCTTTATCAAAGCC
TTTGCCAAGTCCATTGAATTCACTTATGCAAATCCAGATCAAGCCGGTATCGACCTGCAC
GCTATGGTGCCTGAAGTGGATGCCAGTATTGTCTCTGCACAAATTAAGAGCATTTATAAT
TTGGTGTACAACGATGTCACGACAAAAGATGGCTTCGGTAATTTCACCGACGAACGCATT
CAAAAAACTTGGGAATACGTGGCTGAAGCAAACGGTTTAAAAATGGATGCTATTGATCCC
AAAAAAGCAGTAAACAGCAGCTTTAAGCCGGAGTAA