METABLE2 Genes

PROKKA_00116 Marinomonas

GenomeMarinomonas ctg_1:109167-110153
ProductCDS 2OG-Fe(II) oxygenase superfamily protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF03171.14
Sequence
>PROKKA_00116 2OG-Fe(II) oxygenase superfamily protein
ATGACTAATTCATATTCACTTGAAGAACTACAACGCGAAACCACGTTTGGCGGTGCAGGC
GAAGACACCAACGAACGAGAAATTCGCATCATCGACATGAGCGATTTTGAAAATCGCAGA
GAAGAAATCACTGAGCAACTTTGGCTTGCGGCCACCGAGATTGGTTTTTTCCAATTAAGT
AACCACGGCATTGATCCACAAGAAATCAAAGCCGCATTCAAAGAATCCGAGCGTTTTTTT
AATCTTCCAGAAAGCATTAAAGGAAAATACCCACGACCAAAAAGCGTCAATGCGGGCTGG
GAAAGCCGTAGCCAAATACGCCCTTCTACTGGCACCAAAGATCAAAAAGAGTCTTATCAG
ATTACCCAATACCACATGGATAATTTGTGGCCGAGCGAAGATGAGTTACCAAACTTTCAA
GCCAATACGCTGCATTTTGAAAAACAATGTTGGGAAGTGGGCATGAAGGTATTGTCTTGC
TTTGCCGACAAGCTAGGTTTTGATCGAGACTTCTTTAGCAAAGCACACGATCCTCGCCAG
CCAGACTACCAAAGTACCTTACGCTTGTTGCATTATTACGCCACAGAAGGTGTCACCGAA
CAGGGTAATATTTGGCGTGCTGGCGCGCATACGGATTTCGATTGTTTAACCTTATTATTT
CAACACGAAGGCCACGGCGGTTTACAAGTTTGCCCGGGTGCGGAAGCTGAAACTCAACGT
TGGACAAGCATTCCGCCCCTTGGCGGCGTGATCACCTGCAACATCGGCGATATGCTCATG
CGCTGGAGCGACGACCAACTTAAATCCAACCTGCACCGAGTACGTCAACCACGTGTCGAC
GAATACTGTGGCAGTCGTCATTCCATTGCCTTCTTTTGCCAAGCCAATAAAACGCAGATC
ATCGAAGGCCCAGCCAAACGCTACCACCCCATCAGTGCGGCAGACTTTTTGACCCAACGT
ATTCAGGCTAATTTTGTAGATAAATAA