METABLE2 Genes

PROKKA_00131 Marinomonas

GenomeMarinomonas ctg_1:125648-125878
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00131 hypothetical protein
ATGATGATTGTAGATTTGGTCGACGAAGTCGATTTTAAAGAAAGACTCATCGCGTTAGGA
GCGCCCGTTACTCAAGAGCAAAGTTTGGCACAAGTACAGTCCGCTGTGCTGTCTTGGTTG
CAGTCATATCCAGAGCAAACTCCGTTCGTAAAAGATCTTTGTACCGAAATGCAAAAAGAC
AACACGACTGTTTTGCCAGAAGTCTCTACTGTCATGGCTGCATTTGGTTAA