METABLE2 Genes

PROKKA_00002 Pseudomonas

GenomePseudomonas ctg_1:1113-1829
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00002 hypothetical protein
ATGCACACATTTCGCCGCAGCGCCGCCCTCCTCGCCCTGACCGTCGGCAGCGCCGCCAGC
CTCCCGGCGCTGGCCGCCGAAGAGCTGCACTACAACCAGATTTCCCTGCGCGCCGAAGTC
AGCCAGGAAGTGGCCCGCGACCAGATGATCGTGACGCTCTACACCGAAGAGCAGAACACC
GACCCGGCCAAACTCGCCGCCGCCATCAGCACCACCATGAACAAGGCCACCGCCCAGGCC
AAACAAGTCAAAGACATCACCCTGCGCACGGGCAGCCGCAACAGCTATCCGATCTACGAC
ACCAAAGGCCAGAAGATCACCGTCTGGCGCGAGCGCGCCGAACTGCGCCTGGAAAGCACC
GACTTCGCCGCTCTGTCCAAACTCACCGGCGAGTTGCTGACCGACCTGAAAATGGGCGGC
ATGGACTTCGCCATCGCCGACCCGACACGCAAGACCAGCGAAGACCAGTTACTCAAAGAA
GCCGTCACCGCCTTCAAGACCCGCGCCCAACTGGCCACCGATGCACTGGGCGGCAAGGGC
TACAAAATCGTCAACCTGAACCTCAACAGCAACGGTTACCCACAACCGTACCTGCGCGCG
CCGATGATGATGAAAGCCGCAGCCATGGATTCCGCGCCAGTCACGCCGGAAGTCGAAGCC
GGCACCAGCCAGGTCAGCATGACCGCTGATGGCTCGATTGAAGTGTTGATGCAGTGA