METABLE2 Genes

PROKKA_00003 Pseudomonas

GenomePseudomonas ctg_1:2090-2275
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00003 hypothetical protein
ATGGCTAGTGAACAGGAAAAGCAAGATGCTAGAGCTGGTGGATACACGGTTTCGCTTGTT
GGTAAAGGGACCTATGACACCTATGTTGTTTACCATCACGGAAGTGAAAAGGGAGAATTC
GCGTTGCTGGAGGACGCCTGGAATCACGCGGTCTCCATGCGACAGGCGGAACTGTACAAC
CATTAA