METABLE2 Genes

PROKKA_00008 Pseudomonas

GenomePseudomonas ctg_1:7059-7439
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00008 hypothetical protein
ATGTCGATGCATTTTGCCGCCCCCACCCTCACCCACGTCGCCCCTGCGCAAGACGATTGC
GTGACGCTTCAGCTCTCGCAATTGCCGGACATCATCACCGTGCAGGTCCCGGATTCCAGC
GATTTCGCCGCGAACTGGAGCGTCTACGCGATTCTCGGCAGCGATGGAGAAGAACCCGAA
TGGGAAGGTGATGAAGTGGACACTGGCGCCTGGGACGACGCCGAGGATGAAATGGAAAAG
CTGCTCGACATCGAGGTGCAGCTGCCCAAAGAGGCGCTGCAACCTTACCTGAACCGTGAG
GTGGATCTGCGTTACAAGTTTCGCGATGAGTCGAGCATGGAGCCGTATTCGCTGCCGCTG
CGAATGCGCATAGAGGCGTAA