METABLE2 Genes

PROKKA_00009 Pseudomonas

GenomePseudomonas ctg_1:7738-8649
ProductCDS putative 5-dehydro-4-deoxyglucarate dehydratase
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:Q6FFQ1
Sequence
>PROKKA_00009 putative 5-dehydro-4-deoxyglucarate dehydratase
ATGAATCCACAAGAACTGAAGTCCATCCTCTCTGCCGGCCTGCTGTCTTTCCCGGTAACC
GATTTCAACGCGCAGGGCGATTTCAACCGCGCGGGCTACATCAAACGCCTGGAATGGCTG
GCTCCGTATGGCGCTTCGGCTCTGTTCGCCGCCGGTGGCACCGGTGAGTTCTTCTCCCTG
GCCGCCAGCGAATACTCGGAAATCATCAAGACTGCCGTCGACACCTGCGCAACCAGCGTG
CCAATCCTCGCCGGCGTTGGTGGTTCGACCCGCCAGGCCATCGAATACGCTCAGGAGGCC
GAGCGTCTGGGCGCCAAAGGTCTGCTGCTGCTGCCGCACTACCTGACCGAAGCGAGCCAG
GACGGTGTTGCCGCCCACGTTGAAGCCGTGTGCAAATCGGTGAAGATCGGCGTGGTCGTC
TACAACCGCAACGTTTGCCGTCTCACCGCGCCGCTGCTGGAACGTCTGGCCGAGCGCTGC
CCGAACCTGATCGGCTACAAGGATGGCCTGGGCGATATCGAGTTGATGGTTTCGATCCGT
CGCCGCCTCGGTGATCGCTTCAGCTACCTGGGTGGTCTGCCGACCGCTGAAGTCTACGCC
GCTGCCTACAAGGCGTTGGGCGTGCCGGTGTACTCCTCGGCGGTGTTCAACTTCATCCCG
AAAACCGCGATGGACTTCTACCACGCGATCGCTCGCGAAGATCACGCCACCGTCGGCAAG
ATCATCGACGACTTCTTCCTGCCGTACCTCGACATCCGCAACCGCAAGGCCGGTTACGCG
GTGAGTATCGTCAAGGCAGGTGCAAAAATCGCCGGCTATGACGCAGGTCCGGTGCGTGCG
CCGCTGACCGACCTGACCGGCGAAGAGTACGAAATGCTCGCCGCGCTGATCGACAAGCAA
GGCGCGCAATAA