METABLE2 Genes

PROKKA_00014 Pseudomonas

GenomePseudomonas ctg_1:13465-14406
ProductCDS Membrane transport protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF03547.12
Sequence
>PROKKA_00014 Membrane transport protein
ATGCTGGCAATCTTTCTTGAAACCCTGAACATCACCGCGCCGGTGTTTGCCATGCTGTTT
CTCGGTGTGCTGCTCAAGCGCATCGACTGGATCAACGACAACTTCATCCACACCGCCTCG
TCGCTGGTGTTCAACGTGACCATGCCGGCGCTGCTGTTTCTCGGCATCCTCCACGCTGAC
CTGCACGCCGCACTGCAACCCTCGCTACTCATCTACTTTTCCCTCGCCACCCTGGTGAGT
TTCGCCGTGGCCTGGGGCTGGGCGATTTTCAAGTGTCCGCGGGAAGATCGCGGCATCTAT
ACCCAGGGTGCGTTTCGCGGCAACAACGGCGTGATCGGTCTTGCACTCGCCGCGAGCATG
TACGGCGATTACGGCATTTCCCTCGGGGCGATTCTGGCGGCGCTGGTGATCCTGTTCTAC
AACACCCTGTCGACCATCGTGCTGGCGGTGTACAGCCCGGTGATCAAGTCCGATCCGTGG
AGCATCTGCAAAAGCGTGTTCAGCAACCCGCTGATCATCAGCGTGATTTCGGCAGCGCCG
TTTGCCTATTTCAAGATCGGACTGCCGGGCTGGCTGGAGACCTCCGGCCAGTATCTGGCG
CAGACTACTTTGCCACTGGCGCTGATTTGTATCGGCGGCACGCTGTCGCTGGCGGCGCTG
CGCAAGAGCGGCAACATGGCGCTCAGTTCCAGCCTGGTGAAGATGATCGGTCTGCCGGTG
CTGGCGACACTGGGGGCATGGCTGTGGGGCTTTCGCGGGGCGGAATTGGGGATTCTGTTT
CTCTACTTCGGTAGCCCGACGGCGGCGGCAAGTTTCGTCATGGCCCGGGCGGCGCAGGGC
AATCATGAGCTGGCAGCGGCGATTATCGTGATGACCACGTTGATGGCGGCTATTACCACC
AATGTCGGGATCTTTGTGTTGCAGTGGGGTGGGTGGATCTGA