METABLE2 Genes

PROKKA_00015 Pseudomonas

GenomePseudomonas ctg_1:14491-14868
ProductCDS Carboxymuconolactone decarboxylase family protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF02627.1
Sequence
>PROKKA_00015 Carboxymuconolactone decarboxylase family protein
ATGAGCGAGTCGAAGCAGTCCGGGGTTGAAATCCGTCGTCAGGTCATGGGCGATGCGTTC
GTTGATCGCGCCTTGGGCAACGCCACCGAGTTCACCCAGCCGTTGCAGGATTTCGTCAAT
GAACACGCCTGGGGTGGCGTGTGGAATCGCGAAGGTTTGTCGCTGAAAACCCGCAGCCTG
ATTACCCTCGCCGCGCTGACCGCGTTGAAGTGTCCGCAGGAGTTGAAGGGCCACGTGCGC
GGTGCCCTGAACAACGGCTGCACGGTGGAAGAGATTCGCGAAGCGCTGCTGCATTGCGCG
GTGTATGCCGGCGTACCGGCGGCGATCGATGCGTTTCGCGCGGCGCAGGAAGTGATTGAT
AGCTACCAGAAAAGCTAA