METABLE2 Genes

PROKKA_00017 Pseudomonas

GenomePseudomonas ctg_1:15973-16344
ProductCDS RlpA-like protein precursor
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:Q57092
Sequence
>PROKKA_00017 RlpA-like protein precursor
ATGAAGCGTCTGTTGCTGAGCAGCGCCCTGCTCTCTCTGCTGGCCGGTTGCGCCAGTACC
GACACCATCGACCCGCACGGTTATGACCAGACCGGCGTCGCCTCCTATTACGGAGCCAAA
CATCACGGTAAGCGCACCGCCAGCGGCGAAGCGTTCAACCAGCATTCCCTGACCGCCGCC
CACCGCCAGTTGCCGTTCGGCACGCGGGTGAAGGTCACCAACCTGAAAAACGATGAATCA
GTCGTGGTCCGCATCAATGACCGTGGCCCGCACACCCGTGGCCGGCTGATCGATCTGTCA
CGCGAGGCCGCCGATGAGATCGGCATGCTGCGCAGCGGCACCGCACGGGTTCGCGTGCAG
GCCCTCGACTGA