METABLE2 Genes

PROKKA_00026 Pseudomonas

GenomePseudomonas ctg_1:24984-28787
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK10899
Sequence
>PROKKA_00026 hypothetical protein
ATGGAGCGTCTGACACGCATTCTGGCCGCACTCACCCGCTGGGGGCTGGGCCTGTGCGCG
TTGGTTCTGGTGTTGATGGCTTTGTACGTCAGCCTCGGCCGCGAGCTGACCCCTCTGGTG
GCGGAATACCGCGCCGACATCGAAGACAAGGCCAGCGCCGCCCTCGGCATGCCTTTGCAA
ATCGGTGAGCTGGAAGGCAACTGGAGCGGTTTCGCACCGATCCTGCTGGCCCATGACGTG
ATGGTCGGCGACGGCGCCAACGCGCTGCGCCTCGACCGCGTGCGGGTAGTGCCGGATATG
TGGGGCAGCTTGCTCGCCCGCGAAGTCCGTCTCGCGCATATCGAACTCAACGGTTTGAAG
ATCAGCCTCAAGGAAGCCGAAGACGGTACCTGGGCGCTGGAAGGCCTGCCGGTGCAGAAG
GATCAACCGTTCGATGCGGTGCAAATGTTCCAGCGCTCGCAGATGATCAGGCAATTTTCA
GTGCTCGACAGCCAGGTGACCCTGCAACCGCTCGATCACCCTCCCATGACGCTCACCTAT
GTCGGCCTCAATCTGCGTACCGGCGCCAGCCGCCAGCGTCTCGACGCGCGTCTGACCTTG
CCCGATGGCCAGCCTGTCGCGCTGAGTCTGCGCAGCCAGCTTCGTCCCGATCAGTGGCAG
AACAGCGCCATCGAGGGTTATGCCAGCCTGCCGCAGAGCGACTGGTCGAAATGGCTTCCC
GAGCGCCTGACCCAGCAATGGAATTTTTCCGAGATCAAGGCCGGCGGCGAACTCTGGGTC
GATTGGTCCGAAGGCGCTTTGCAAAGCGCCGCGTTGCGCCTGAATGCGCCGCAAGTGACC
GGTGCCTACGCCGAGCGCAAGCCGATCCAGATCAACAATCTGGCGCTCAACGCCTATTAC
CGCAACACCGCCGAAGGGGTGAAAGTCACTCTTGATTCACTGGCGATGAGCTTCGGCGAA
ACCCGCTGGGAATCCCATGTGCAGGTGCAGCAGACCCGCGCCAGCGCCAAGGCTGAAGAG
CTCTGGCATCTGCAGGCCGATCGCCTCGATCTGACCCCGATCACGCCGCTGCTCAATGCG
CTGGGGCCGTTGCCACAAAGCTTCGCCACAGTGGTCGAGCGTTTGAAGGTAACCGGCGGC
CTGCGTAATGTGCTGCTGGACTTCCGCCCGACCGCCACCGATGGCAACAAATTCGGCTTT
GCCGCCAACCTCGACAACGTCGGTTTCGATGCCTACCACGGCGCTCCGGCGGCGCGCAAT
GTCAGTGGCAGCCTGAGTGTCAACCTCGACGGCGGCGAGTTGCGCCTCGACAGCAAGGAT
TTCGTCCTGCACCTCGATCCGATTTTCGCCAAGCCATGGCAATACCTGCAGGCCAATGCG
CGGTTGACCTGGAAGCTCGACAAGGATGGCTTCACCCTGATTGCGCCATACCTCAAGGTA
TTGGGCGAGGAGGGCAAGATTGCCGGCGATTTCCTCATTCGCCTGCACTTCGACCATAGC
CAGGAAGACTACATGGACCTGCGCGTCGGCCTGGTTGATGGCGACGGTCGCTACACCGCG
AAATACCTGCCGGCGGTGTTGAGCCCGGCGCTTGATGAGTGGCTGCGCACAGCGATCCTC
AAAGGCGCAGTGGACCAGGGTTTCTTCCAGTATCAGGGCTCGCTGAGCAAGAACGCCGGC
GAGGCTGATCGCAGCATCAGCCTGTTCTTCAAGGTCCATGACGCCGAACTGGCCTTTCAG
CCTGGCTGGCCCCATGTGAGCAAGGTCAGCGGCGATGTGTTCATCGAAGACAGCGGCGTG
CGCATCTGGGCCAGCAAAGGCCAGTTGCTCGATACGCAAGTCAGCGATGTCTTCGTCAAT
ATTCCTCATGTACCGGCCGGGCAGAACTCGCATTTGTTCCTGGATGGCGCATTTGCCGGT
GGCCTCGGCGACGGCTTGAAGATTCTTCAGGATGCGCCGATCGGCACTGGCGAGACCTTT
GCTGGTTGGGAGGGTGCGGGTGATCTGAATGGCAAGCTCAAGCTCGATATTCCGCTGGCC
AAGGGCGAGGAACCTAAAATCCTCGTCGATTTCAAAACGGCCAACGCGCGGCTGAAACTG
GCCGAACCGAAGCTCGAACTGAGCCAGCTCAAGGGCGATTTCCGCTTCGACAGCAATAAA
GGCCTCAGCGGCCAGAACATCTCTGCACGGGCCTTCGACAAACCGGTCACTGCGCAGATC
TTCGCTGATGGCAGCCCCAACCAGATCAAGACCCGGGTTGCGGCGTCGGGGCAGGTTGAA
GTGAAAAAGCTCACCGATTGGCTGGGCGTGACCCAGCCGTTGCCGGTGTCCGGGACGATT
CCTTATCAGTTGCAGCTGAATCTTTCCGGGGCCGACAGCCAGTTGCTGGTCAGCTCCAGC
CTCAAAGGCGTGGCGGTGGATCTGCCGGCGCCGTTCGGCATGACCGCCGATGTCGGACGC
GACACGGTATTCCGCATGACCTTGCAAGGGCAGGAGCGGCGGTACTGGTTCAATTATGAT
CAACTGGCCAATTTCACTTTTGCTGCGCCGCCGAGCAATTTCGCCGATGGCCGTGGCGAA
CTGTTTCTCGGTGCTGGCGAAGCGGTGTTGCCGGGCGCCAAGGGCCTGCGCATTCGCGGG
GTGCTGTCGGAACTGGACGTCGCGCCGTGGCAGGATCTGGCCAGCAAGTACGCTGGCGGG
GATCCGGGCGGCAGCGCCAAGCAACTGCTGAGCAGCGCTGACATCAAGGTCGGCAAATTG
ACCGCGTTCGGCACCACGCTGGATCAGGCTGCGGTGCAGATCAATCGCAAGCCAGGCGCG
TGGAACCTGGCGCTGGATAGCCAACAGGCCAAGGGCAGCGCCAGCCTGCCGGATGCCAAC
GGCGTGCCGATTGCGGTGAATCTGCAATACGTGAAACTGCCGGCGCCGGACCCGGCGGTG
CAGGCTGACGAGAACGCGCCTGATCCATTGGCGTCGGTCGACCCGACGAAAATCCCGGCG
CTGGATATCACCCTCAATCAGTTGTTCCTCGGCCCCGATCTGGTCGGTGGCTGGTCGCTG
AAAGTGCGGCCGACGGCCAAGGGCATCGCACTGAACAACCTCGACATGGGCCTCAAGGGT
ATCCTGCTGCAAGGCAACGGCGGCTGGGAAGGCGCGCCGGGGGCGACCAGCAGTTGGTAC
AAGGGCCGCATTGGCGGCAAGAATCTGGCCGACGTGCTCAAAGGCTGGGGCTTCGCGCCA
AGCGTGACCAGCGAAGAATTCCATATGGATGTCGACGGCCGTTGGCCGGGCTCGCCGGCG
TGGCTGGCGACCAAGCGCTTCTCCGGCACCCTCGATGCCTCGCTGAACAAAGGCCAGTTC
GTTGAAGTGGAAGGCGGTGCTCAGGCGCTGCGGGTGTTCGGCCTGCTCAACTTCAACTCG
ATCGGCCGGCGCCTGCGTCTGGACTTCTCCGACCTGTTCGGCAAAGGCCTGAGCTACGAT
CGGGTCAAAGGCCTGCTGGTGGCGAACAATGGTGTCTACGTGACACGTGAGCCGATTCGC
CTGACCGGGCCTTCGAGCAACCTGGAATTGGACGGCACGCTGGATCTGGTCGGTGACAAG
GTCGATGCGAGATTGCTGGTGACCTTGCCAGTGACCAACAACCTGCCGATCGCCGCGTTG
CTCGTCGGCGCACCGGCGGTCGGCGGCGCGCTGTTCCTCATCGACAAGCTGATCGGCGAC
CGCGTCGCGCGCTTCGCCAGCGTCAAGTACACCGTCAAAGGCCCATGGAAAGAGCCGAAA
ATCACCTTCGACAAGCCTTTTTAA