METABLE2 Genes

PROKKA_00027 Pseudomonas

GenomePseudomonas ctg_1:28916-29776
ProductCDS 2-oxoglutaramate amidase
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:Q93NG1
Sequence
>PROKKA_00027 2-oxoglutaramate amidase
ATGTCTTTAGCGGTGATTCAAATGGTCAGCCAGAGCGACGTGCCGGTCAATCTGGCCCAG
GCCCGACGCTTGCTCGAACAGGCCGCCGCCGGCGGGGCGAAACTCGCGGTGCTGCCGGAA
AACTTCGCCGCCATGGGCCGTCGCGACGTCGCCGATATCGGCCGCGCCGAGGCCTTGGGC
GAAGGGCCGATCCTGCCATGGTTGAAACAGACCGCCCGCGACCTCACCTTATGGATAGTC
GCCGGCACGTTGCCGTTGCCACCGTTGGGTCAACCCACGGCCAAAGCCAATGCCTGCTCA
TTGCTGATCAACGAGCACGGCGAGGTGGTCGCGCGCTATGACAAGCTGCATCTGTTCGAT
GTCGATGTCGCCGACAATCGCGGCCGGTACCGTGAATCCGATGACTATGCTTATGGCGGT
AATGTAGTGGTGGCGGATACGCCGGTGGGGCGAGTCGGTCTGAGCGTGTGTTACGACTTG
CGTTTCCCGGAGCTGTACAGTGAATTGCGTGCCGCCGGTGCCGAATTGATTACCGCACCG
TCGGCGTTTACGGCCGTAACCGGCGACGCGCACTGGGATGTACTGATCCGCGCGCGGGCC
ATCGAAACACAGTGTTATATCCTCGCGGCCGCGCAGGGCGGCAGCCATCCCGGACCGCGT
GAAACCTTCGGGCATGCGGCGATTGTCGACCCGTGGGGGCGCGTGCTGGCCCAACAGGAT
CAAGGCGAGGCGGTGTTGCTGGCCGCCCGCGACAGCGATGAACAAGCGTCCATCCGGGCG
CGCATGCCGGTGACGCGTCATCGGCGGTTTTTCTCGCAGGGCGCCCAGCGGCCTGCTTCA
GAACACGAATTTAAGGCGTAA