METABLE2 Genes

PROKKA_00028 Pseudomonas

GenomePseudomonas ctg_1:29781-31223
ProductCDS protease TldD
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK10735
Sequence
>PROKKA_00028 protease TldD
ATGAGCGAGTTGTTGTCCTCAGTCAGTGATCACCTGTTGGCACCCGGCGGTGTCACGATC
GAGAGCCTGCAAGGCGTGCTCGGCGATCTGGCCGGGCCGGGCATCGATGCCGCCGACCTG
TATTTCCAGGGCCAGATTTCCGAGTCATGGGCGCTGGAAGACGGCATCGTCAAGGAAGGC
AGCTTCAACCTCGATCAGGGTGTCGGCGTGCGTGCACAGTCCGGTGAGAAAACCGGTTTT
GCCTACAGCAACGCGATCACCCTTGAAGCTCTCGGCGCAGCGGCCCGCGCCGCGCGTTCG
ATCTCCCGCGCCGGACAGAACGGCACCGTGCAGGCGTTCACCAGCCAGGACGTCGCGCAG
TTGTACGCGCCCGATAACCCGCTGGAAGTGCTCAGCCGCGCGGAAAAAGTCGAGTTGCTC
AAACGCATCGACGTCGCCACCCGCGCACTCGACCCACGCATTCAGCAGGTCAGCGTGAGC
ATGGCCGGGGTCTGGGAGCGAATCCTTGTTGCGTCTACCGATGGCGGTCTCGCCGCCGAC
GTGCGCCCACTGGTGCGTTTCAACGTAAGCGTCATCGTCGAACAGAACGGCCGGCGCGAA
CGCGGCGGGCATGGCGGCGGCGGGCGTACCGATTACCGCTACTTCCTCGCCGAAGACCGC
GCCATGGGTTATGCCCGCGAGGCGCTGCGCCAGGCACTGGTCAACCTTGAAGCAATTCCA
GCGCCGGCCGGTACCTTGCCGGTGGTGCTGGGTTCCGGCTGGTCCGGGGTGCTGTTGCAC
GAAGCGGTCGGTCACGGTCTGGAAGGCGATTTCAACCGCAAGGGCAGCTCGGCCTATAGC
GGGCGCATGGGTGAAATGGTTGCCTCCAAGCTATGCACCATCGTCGATGACGGCACCTTG
AGCGGCCGTCGCGGTTCGCTGAGCGTCGATGACGAAGGCACGCCCACCGAGTGCACTACG
CTGATCGAAAACGGCGTACTCAAGGGCTACATGCAAGACAAGCTCAATGCGCGCCTGATG
GGCGTGGCGCGGACCGGTAACGGTCGTCGCGAATCCTATGCGCATCTGCCGATGCCACGG
ATGACCAACACCTACATGCTCGGTGGCGAAAGTGATCCGGCGGAAATCATCGCCTCGGTG
AAGAAGGGCATCTACTGCGCCAACCTCGGCGGCGGTCAGGTCGATATCACCAGCGGCAAG
TTCGTGTTCTCGACCAGCGAGGCTTATCTGATCGAGGACGGCAAAATCACCGCACCGGTC
AAAGGCGCGACATTGATCGGCAACGGCCCCGAGGCGATGAGCCGGGTGTCGATGGTCGGT
AACGATCTGGCGCTGGACAGCGGTGTGGGTACGTGCGGCAAGGATGGGCAGTCGGTGCCG
GTGGGTGTCGGCCAGCCAACGCTGAAAATCGATGCGATTACCGTGGGTGGCACGGGCGCA
TAA