METABLE2 Genes

PROKKA_00029 Pseudomonas

GenomePseudomonas ctg_1:31275-31799
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK05255
Sequence
>PROKKA_00029 hypothetical protein
ATGGTTGATTCTTACGACGACTCCCTCGATACGGGAGAAAAAAGCAAATCTCAGGTCAAA
CGCGAGTTGCATGCGCTGGTTGACCTCGGCGAGCGCCTGACCACACTCAAGCCTGATCTG
GTCGCCAAACTGCCGTTGACCGACGCTTTGCGCCGGGCATTGGCCGATGCGCCCAAGCAC
ACCGCGAATATCGCGCGTAAACGGCATTTGCAGTTCATCGGCAAACTGATGCGCGACCAG
GACACTGACGCGATTCTGACTCTGCTCGATCAACTCGATGCCTCCACTCGCCAGTACAAC
GAGCGTTTCCATAATCTGGAACGCTGGCGTGACCGCCTGATCGCGGGCGATGACGCCGTG
CTGGAGAAATTCGTCATCGAGTACCCGGACGCCGATCGCCAGCAATTGCGTTCCCTGATC
CGTCAGGCCCAGCATGAGGTTGCGCAAAACAAACCACCTGCTTCGAGCCGCAAGATCTTC
AAATACATTCGGGAGCTGGACGAGACTCAACGCGGCCTGCGTTGA