METABLE2 Genes

PROKKA_00030 Pseudomonas

GenomePseudomonas ctg_1:31908-33254
ProductCDS peptidase PmbA
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK11040
Sequence
>PROKKA_00030 peptidase PmbA
ATGAGTGCAGTTCAAAGCGTCGGCCCGCAGGCATTGCCGGCACTGCAAGAACAGGTCGAG
CAGATCATCGCCGAAGCCAAGCGCCAGGGCGCCAGCGCCTGTGAAGTTGCGGTGTCGCTG
GAGCAGGGGCTGTCGACCTCGGTGCGTCAGCGCGAGGTCGAAACCGTTGAATTCAACCGT
GATCAGGGTTTTGGCATCACCCTGTACGTCGGCCAGCGCAAAGGCTCGGCCAGCACCTCC
GCCACCGGGCCGGAGGCGATTCGTGAAACCGTAGCGGCGGCACTGGCCATCGCCAAACAC
ACGTCCGAGGACGAAGCCTCGGGTCTGGCCGACGCTGCACTGATGGCCAGGGATGTGCAG
GATTTCGACCTGTTCCACGAATGGGACATCACCCCGGAGCAGGCCATCGAGAAGGCTTTG
CTCTGTGAGGCCGCGGCGTTCGATGCCGATGCGCGAATCAAGAACGCCGACGGCACCACC
CTCAGCACCCATCAGGGCTGCCGGGTTTATGGCAACAGCCACGGTTTCATCGGCGGTTAT
GCGTCGACCCGGCACAGCCTGAGTTGCGTGATGATCGCTGAAGCCGATGGCCAGATGCAG
CGTGATTACTGGTATGACGTCAATCGCCAGGGCAGTCTGCTCGCCGATCCGGTGAGCATC
GGCCAGCGTGCCGCGCAACGGGCGGCGAGCCGTCTGGGCGCGCGGCCGGTGCCGACATGC
GAGGTGCCGGTACTGTTTTCCGCCGAACTGGCGGGCGGTCTGTTCGGCAGTTTCCTCTCG
GCCGTGTCGGGCGGCAGCCTGTATCGCAAATCGTCGTTTCTCGAAGGCACACTCGGGCAA
AAGCTGTTCCCGGAATGGCTGACCATTGATGAGCGTCCGCATCTGATGCGTGCCATGGGC
AGTGCTTCCTACGACGGTGATGGCCTGGCGACTTACGCGAAACCGTTCGTCGAAAAGGGC
GAGTTGGTCTCCTACATCCTCGGCACCTATTCCGGGCGCAAACTGGGCATGCCGAGCACC
GCCAACGCGGGCGGGGTGCACAACCTGTTCGTCACCCACGGTGATGAGGATCAGGCAGCA
CTGCTCAAGCGCATGGGCCGAGGACTGCTGGTCACCGAGTTGATGGGCCACGGCCTGAAC
ATGGTCACCGGCGACTATTCGCGCGGCGCGGCGGGCTTCTGGGTGGAAAACGGCGAAATA
CAGTTCGCCGTGCAGGAAGTGACCATCGCCGGCAATATGCGCGACATGTTCAAGCAGATT
GTTGCGGTGGGTAATGATCTGGAACTGCGCAGCAACATCCGCACCGGGTCAGTATTGATC
GAGCGGATGACTGTCGCCGGCAGCTAA