METABLE2 Genes

PROKKA_00031 Pseudomonas

GenomePseudomonas ctg_1:33726-34166
ProductCDS Tetratricopeptide repeat protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF07719.11
Sequence
>PROKKA_00031 Tetratricopeptide repeat protein
ATGGAGCACTGGAAACGCACGATCGAACGGGCCAATCGCTGCTTCATGCTGGGCGAACTG
ATCGACGCCCGCGAGGCTTACCTGCAAGCCCTGGCCCTGGCGCAAGTGTTGTTCGAACGC
TGGGCGGATGCCGACGAAGCGGTGGCGGCCTGCGTCGTCTCACATCACAACCTGGCTGAC
CTGCATCTGCGCCTGAACCAACCGGAGGAGAGCGCCGAATATCTCTGTGCCATCCATCAA
CGTTTGTTGAAGACCATGCAGGACGAGCGCTTGCGTCCGGCCCTGCGTGAGGCGGCGCTG
CGCCAGAGCAGCAAGACCTATGTCGAACTGTTGAACTTCATTAGCGAGCACGGCGAATAC
CCACGCAACCAGCGCCTGCTGCATCCGGACACCGGCAATGCCCGCCGCGCCTCAAATCCC
CATCAGTATGGAGTCCATTGA