METABLE2 Genes

PROKKA_00035 Pseudomonas

GenomePseudomonas ctg_1:36028-36885
ProductCDS glmZ(sRNA)-inactivating NTPase
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK05416
Sequence
>PROKKA_00035 glmZ(sRNA)-inactivating NTPase
ATGCGTTTGATCATTGTCAGTGGCCGTTCGGGCTCGGGTAAAAGTACCGCCCTGAATGTC
CTTGAGGACAACGGCTACTACTGCATCGACAATCTGCCGGCCGGTTTGCTGCCGGAACTG
GCCGAGCGAGCGCTGATTCACACAGAACTGGCGCAGCCGCTGGTCGCCGTGTCGATCGAC
GCGCGCAACCTGCCCAGCCATCTGTCACGTTTCCCTGAGTTGCTCGAAGACGTGCGTGCC
AAGCATATCAAGTGCGATGTGCTGTACCTGGACGCCGATGAAGAAACCCTGCTCAAGCGT
TTTTCCGAGACCCGTCGTCGTCACCCGCTGAGCAACGCCAATCGCTCACTGGCCGAGGCG
ATTCACGACGAAACCGCCCTGCTTGGTCCGATCGCCGATCTGGCCGACCTGAAGATCAAC
ACCACCAGTCTGAATCTGTATCAACTGCGCGACACCATCAAGTTGCGCCTGTTGAATCAA
CCGGAGCCCGGTACGGCGTTTCTGGTCGAGTCGTTCGGCTTCAAGCGCGGCATGCCGGTC
GACGCCGACCTGGTGTTCGACGTGCGCTGCCTGCCCAATCCGTACTGGAAACCGGAGCTG
CGCGCGCAATCCGGCCTCGATGCCCCTGTGGCCGAGTACCTGGCGCAGCAGCCGGATGTC
GAAGAAATGTATCAGGACATCTACGCCTACCTGAACAAGTGGCTACCACGCTTCGCCGCC
AGCAACCGCGCCTACGTCACCATTGCCATTGGCTGCACCGGCGGGCATCACCGCTCCGTC
TACCTGACCGAACGACTGGGTCAGGCCCTGCAGAAAACCCTGAAGAACGTCCAGGTTCGC
CACCGCGACCTCACCTAA