METABLE2 Genes

PROKKA_00041 Pseudomonas

GenomePseudomonas ctg_1:40660-41232
ProductCDS lipopolysaccharide exporter periplasmic protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK10893
Sequence
>PROKKA_00041 lipopolysaccharide exporter periplasmic protein
ATGTTTAGCAAAAAGTTTCGCAATTTCCTGCTGTTCGGCTGCATCGCGGCGATTTTCGCT
GCGGTGGGCTACTGGAACATAAGCCCCGAGCGCTTCCTCGACAAGCCGCCGGTCTCGGCC
GCCGAGAATCCGATCGACTGGTACGCGACCAACACGCACACCATTCAATACCTGCCCGAC
GGCAAGGTGCAGTATGAGATGACCTCCGACAAGGCCGAGCACGTCAAGGCCACTGATATC
ACGCTGGTAACCAAGCCTGATTTGAACATGTACCGCGGCACCGACTTCCCGTGGCACGTG
ACCAGCGAGCGCGGCGAAGTGAATTCGGGCGGCACCGAAGTGGAATTGATCGATTCGGTC
CGCGTACAGCGCACCGACGAGAAACAGCGCGGCACCCTGATCACCAGCACTCGCATGACC
GTGTTCCCGCAGCAAGAATATGCGCAGACCGCGCAACCCGTTAGAATCGAGGGCGCTGGC
GGCGTATCGACTGGCGTCGGAATGAAAGCGTACCTGAAGGACAGCAGGATACACCTGCAA
TCGAACGTAAGAGGACAGTATGAGGCTCGTTAA