METABLE2 Genes

PROKKA_00044 Pseudomonas

GenomePseudomonas ctg_1:43012-43821
ProductCDS putative ABC transporter ATP-binding protein
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:P45031
Sequence
>PROKKA_00044 putative ABC transporter ATP-binding protein
ATGAGTGCCGATAACGCCTACGCGGTCGAGCTGAAGGGAGTCTCCTTCAAGCGCGGTGCG
CGGAGCATTTTCAATAACGTCGATATCCGCATCCCGCGCGGCAAGGTCACCGGCATCATG
GGGCCTTCCGGCTGCGGCAAGACCACGCTGCTGCGCCTGATGGGCGCGCAGTTGCGGCCG
TCCGGCGGCGAAGTCTGGGTCAACGGGCAGAACCTGCCGACGCTGTCGCGCAGTGATCTG
TTCGATGCGCGCAAGCACATGGGCGTGCTGTTTCAGAGCGGTGCGCTGTTTACCGACCTC
GATGTGTTCGAGAACGTGGCCTTTCCGCTGCGGGTGCACACGCAACTGCCGGAAGACATG
ATTCGCGACATCGTCCTGCTGAAATTGCAGGCCGTGGGGCTGCGTGGCGCCATCGACCTG
ATGCCGGACGAACTGTCCGGCGGCATGAAACGCCGCGTGGCGCTGGCCCGGGCGATTGCC
CTCGATCCGCAGATTCTCATGTACGACGAGCCCTTCGTGGGCCAGGACCCGATCGCCATG
GGCGTGCTGGTGCGCCTGATCCGCCTGCTCAACGATGCACTGGGAATCACCAGCATCGTG
GTCTCGCACGACCTGGCGGAAACGGCGAGCATTGCCGACTACATCTATGTCGTGGGCGAT
GGTCAGGTGCTGGGGCAGGGCACGCCGGATGAGCTGATGAATTCGGATGAACCGCGTATC
CGTCAGTTCATGACCGGTGATCCCGATGGCCCGGTGCCGTATCACTTTCCAGCGACGGAT
TACCGCGCAGATCTTCTGGGGAAGCGTTGA