METABLE2 Genes

PROKKA_00048 Pseudomonas

GenomePseudomonas ctg_1:45768-46052
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00048 hypothetical protein
ATGAGTGATGTCGACGAGCTGGTGCTCAGCGGCGTGCTGGATTACCGCACCGGGCCTGAG
CTGCGCAAGGAAGGGCAGGCGCTGATCAAGTCGAGCAAGGCGTCCGCGCTGGTCATCGAT
TGTTCGGCGGTGCAGAAGTCCAGCAGCGTCGGCCTGTCGTTGCTGCTGTGCTTCATGCGC
GATGCGCAGGCGGCCGGCAAGGCCGTCAGCATCCGTGCGATGCCTGAAGACATGCGCCAA
ATCGCTCAGGTCAGTGAACTGACCGAGCTGTTGGCGCAACCCTGA