METABLE2 Genes

PROKKA_00049 Pseudomonas

GenomePseudomonas ctg_1:46168-46407
ProductCDS BolA-like protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF01722.12
Sequence
>PROKKA_00049 BolA-like protein
ATGCAGGCCGTAGAAGTGAAGAGCTTCCTTGAAGGAAAGCTGCCAGGAACGCTGGTAGAA
GTTGAAGGCGAAGGCTGCAACTTCAAGCTGAACGTGATTAGCGAAGAACTGGCGGCGTTG
AGCCCGGTGAAGCGTCAGCAGCAGGTCTATGCCCATTTGAGCCCATGGATCACCGATGGC
AGCATCCATGCGGTCACTATGAAATTTTTCAGCCGCGCGGCCTGGGCCGAGCGCACCTGA