METABLE2 Genes

PROKKA_00054 Pseudomonas

GenomePseudomonas ctg_1:51095-51814
ProductCDS Nickel uptake substrate-specific transmembrane region
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF10670.3
Sequence
>PROKKA_00054 Nickel uptake substrate-specific transmembrane region
ATGCAATACGGCAAATCCCTTCTGCTCATCGCTGCGCTCTTCACCGGGGAAGTGTCGGCC
CACGGCCTGTGGACAGAGGAACGACGCGGCAACATCGAAGTGATCTACGGCCACGGCGCC
GAAGACAACGCCTTCAAGGCACAAAAAGTCAGCGGTGCCTGGGCTTATGACGCAAGCGGC
AAAATGATCCCGGTCAGCGTCGAGCGCCTGGCCGATCATGCCCGTTTGAAACCATTGAAG
CCGCCGGCGGTGATGGCCGTGGCGCTGAATAATGGCATGTGGTCGCAGACGGCGGACAAG
AAGTGGATCAACGAAGGACGCAGCAAAGTGCCCGGCGCCACCGAGGCCACGCAGACCTTC
AAGTACAGCCTGGCGATCTATCAGCCGGGGGCAAGGTTGCCGAAACTGGACCAGATCAAA
CTGCTGATCCTGCCGGAGGTCGATCCGCTGACGGTCGGGCCGGGCAAATCGTTACCGGTG
CGGGTGCTGCTCGATGGCAAACCGGCGGCAGGGGTGAAGTTGATTGGCGACTATCGCAGC
GCGCCCAACACCCTGAGCACCGAGACCGACAAGGATGGGCGTGCGCAGGTGCTGGTGCGT
AATGAAGGGTTGAATGTGATTGCGGCGCAGGTTGAAGTGCCGGTGAAGAACAACGCGGAT
GTGGACAGTCGTGGGTTGTTCACGTCGCTGACATTCCTTGGGGAACCACATCACGACTAA