METABLE2 Genes

PROKKA_00057 Pseudomonas

GenomePseudomonas ctg_1:55283-56041
ProductCDS Putative GTP cyclohydrolase 1 type 2
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:Q57354
Sequence
>PROKKA_00057 Putative GTP cyclohydrolase 1 type 2
ATGGCCGTTGCCCTCAGCACCCTCGTCGAAGAAGCCGACCGTTACCTGGGCAGTGCGAAA
ATTGCCGATTATTGCCCTAACGGATTACAGGTCGAAGGCCGCCCGCAGGTGATGCGCATC
GTCAGTGGCGTCACCGCCAGCCAGGCGTTGCTCGATGCCGCCGTCGAGGCCGAGGCCGAC
CTGATCCTGGTCCACCACGGGTATTTCTGGAAAGGCGAAAACCCCTGCGTCACCGGCATG
AAACAGCGCCGCTTGAAAACCTTGCTCAAGCACGACATCAGTCTGCTCGCTTATCACCTG
CCGCTGGATCTGCACCCGGACGTTGGCAACAACGTGCAACTGGCGCGTCAGCTCGACATC
ACTGTTGAAGGGCCGTTGGACCCGAGCAACCCGAAAGTCGTCGGGCTGGTCGGTTCGCTG
AATGAGCCCATGACCGCACGGGATTTCGCGCGCAAGGTTCAGGAAGGCATGGGCCGCGAG
CCGCTGCTGATCGAAGGCAGCGGCATGATCCGCCGCGTCGGTTGGTGCACCGGCGGTGGC
CAGGGTTATATCGATCAGGGCGTGGCGGCGGGGGTCGATCTGTTCATCAGTGGCGAGGCC
TCCGAGCAGACTTTCCACAGCGCCAGGGAAAACGACATCAGCTTCATCGCCGCCGGCCAT
CACGCCACCGAACGCTATGGCGTGCAGGCGTTGGGCGAGTATCTGGCGAAGCGCTTTGCC
CTTGAGCATATCTTCATCGATTGCCCAAACCCTATCTGA