METABLE2 Genes

PROKKA_00064 Pseudomonas

GenomePseudomonas ctg_1:64498-65601
ProductCDS NADH oxidase
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:P32382
Sequence
>PROKKA_00064 NADH oxidase
ATGCCTGTTCAAGCCCTGTTCAAACCGTTCCATCTCGGTGCCCTCGAACTGCCGACCCGC
GTCGTCATGGCGCCAATGACCCGCTCGTTCTCCCCGGGCGGCGTGCCGAATTCCAAAGTC
ATCGAGTACTACCGTCGTCGTGCGGCCGCTGGGGTTGGCTTGATCATCACCGAAGGCACC
ACGGTCGGCCACATCGCGTCCAATGGCTATCCAAACGTGCCGCAGTTTTTCGATGAAGCG
CCGCTGGCCGGCTGGAAAAAAGTTGTCGACGCCGTGCACGCCGAGGGCGGCAAGATCGTC
CCGCAACTGTGGCATGTCGGCAGCGTACGCCGCCTCGGCACCGAGCCGGATGCCAGCGTG
CCGGGCTACGGTCCGTCGGAAAAACTCAAGGACGGTCAGGTCGTGGTTCACGGCATGACC
AAACAGGACATCCAGGACGTGATCGCCGCGTTTGCCCAGGCGGCCAAAGATGCGCAAAGC
ATCGGCATGGACGGTGTGGAAATCCATGGCGCTCACGGTTATCTGATCGACCAGTTCTTC
TGGGAAGGCAGCAATCAGCGCAGCGATGAATACGGTGGCAGCCTGGCCAACCGTTCGCGT
TTTGCCATCGAATTGATTCAAGCAGTACGCGAGGCTGTCGGTGAGGGTTTCCCGATCATC
TTCCGCTTCTCGCAATGGAAGCAGCAGGATTACACCGCGCGTCTGGTGCAAAGCCCCGAA
GCGCTGGGTGAGTTTCTCAAGCCGCTGTCTGACGCTGGCGTGGACATTTTCCACTGCTCG
ACCCGACGCTTCTGGGAGCCGGAGTTCGACGGCTCGGATCTGAACCTCGCTGGCTGGACC
CGCAAGCTGACCGGCAAACCGACCATCACCGTGGGCAGCGTCGGCCTGGACGGCGAGTTC
CTGCAGTTCATGGTCAACACCGACAAGGTCGCGCAACCGGCCAGCCTGGAAAATCTGCTG
GAGCGTCTGAACAAAGAAGAGTTCGACCTGGTAGCAGTGGGCCGCGCGCTGCTGGTTGAT
CCGGACTGGGCGCAGAAAGTCCGTGAAGGACGTGAGCAGGATATTCTGCCGTTCAGTCGT
GAGGCGTTGATGACCCTGGTTTAA