METABLE2 Genes

PROKKA_00067 Pseudomonas

GenomePseudomonas ctg_1:68035-68997
ProductCDS Glucosaminate ammonia-lyase
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:Q93HX6
Sequence
>PROKKA_00067 Glucosaminate ammonia-lyase
ATGTCTGAAGTCCGTCATTCGCGAGTGATCATTCTCGGTTCCGGCCCCGCCGGTTACAGC
GCTGCGGTCTACGCGGCCCGCGCCAACCTCAAGCCACTGCTGATTACCGGCATGCAGGCC
GGCGGTCAACTGACCACCACCACCGAAGTCGACAACTGGCCGGGCGATGTCCACGGCCTG
ACCGGTCCGGTGCTGATGGAGCGCATGCGCGAGCACGCCGAGCGTTTTGAAACCGAGATC
GTGTTCGATCACATCAACGCCGTGGACTTCGCTGCCAAGCCGTACACCCTGACCGGCGAC
AGCGCGGTTTACACCTGTGATGCGCTGATCATCGCCACTGGCGCCAGCGCCCGTTACCTG
GGCCTGCCGTCGGAAGAAGCGTTCATGGGCAAAGGCGTGTCGGCCTGCGCGACCTGCGAC
GGTTTCTTCTACCGCAACAAGCCGGTCGCCGTGGTTGGCGGTGGCAACACCGCTGTCGAA
GAAGCGCTGTACCTGGCCAACATCGCCAGCACCGTGACTTTGATCCACCGTCGCGAAACC
TTCCGCGCCGAGAAGATCCTGATCGACAAGCTCAACGCTCGTGTGGCTGAAGGCAAGATC
ATTCTCAAGTTGAACGCCAACCTGGACGAAGTCCTCGGCGACAACATGGGCGTGACCGGT
GCGCGTCTGCGCAACAACGATGGCAGCTTCGACGAAATCAAAGTCGACGGCGTGTTCATC
GCCATTGGCCACACTCCGAACACTTCGCTGTTCGAAGGCCAGTTGACGCTGAAAGACGGT
TACCTGGTTGTGCAGGGCGGCCGTGAAGGCAATGCGACGGCCACTAGCGTCGAAGGCATC
TTCGCTGCCGGTGACGTGGCTGACCACGTTTACCGTCAGGCCATCACCTCGGCCGGCGCC
GGTTGCATGGCGGCACTGGACACCGAGCGTTACCTGGACGGCTTGCAGAACGCCACGTTC
TAA