METABLE2 Genes

PROKKA_00068 Pseudomonas

GenomePseudomonas ctg_1:69187-69525
ProductCDS HopJ type III effector protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF08888.5
Sequence
>PROKKA_00068 HopJ type III effector protein
ATGACTGATCTGAATACCCTGCGCGCCAGCCTCAAGAGTGGCGAGCATGCTTTCGCCGAC
ACCCTGGCGTTCATCGCCGCCGGTTACGACTACCAGCCGCAAGCATTCAACAACGGCGGC
GTGGAAAATGCTGCCGGGCAGAACGAAGGCTCCTGCAAGACCCTGGGTCTGGCACTGCTG
GAAGGTTTGAGCGATGAAGAAGCGCTGCTGGCGTTCGGCGAGCATTACCGTTCGGTCCTG
GCGACGCCCGAGGGCAGCGATCACGGCAACATTCGCGCGTTGATCAAACACGGCCTGGCC
GGGGTCAAGTTCAGCGCAGAACCACTGACCCGCCGCTGA