METABLE2 Genes

PROKKA_00069 Pseudomonas

GenomePseudomonas ctg_1:69518-69814
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00069 hypothetical protein
ATGACTGATCAACAACGCCTGGAACTCGAAGCCGCCGCCTTTCGCCGACTGGTCGCTCAC
CTCGACAGCCGCAAGGACGTGCAGAACATCGACCTGATGAACCTCGCCGGGTTCTGCCGC
AACTGCCTGTCGAAATGGTACAAGGCCGAAGCCGACCAACGTCAGATCGAGGTCAGCCTC
GATGACGCCCGCGAAGTGGTGTACGGCATGCCCTACGCCGAGTGGAAAGCCCAATACCAG
CAAGAAGCCAGCGCCGAGCAGCAAGCAGCGTTTGCCAAAGGAAAACTCAATGACTGA