METABLE2 Genes

PROKKA_00072 Pseudomonas

GenomePseudomonas ctg_1:71117-71686
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00072 hypothetical protein
ATGTCTACTTCCCCCGTCACGCTAATGGTAGCGCGTCGCGTCGCTGATGGCCGTTATCAC
GATCTTATCGCCTGGTTGCGCGAAGGCGAGCAACTGGCCACCGACTTCCCCGGCTACCTC
GGCTCCGGCGTCCTCGCGCCACCGCCCGGTGACAACGAATTCCAGATTATCTTCCGCTTT
GTCGATGAGCAGACCCTGCACGCGTGGGAATACTCGGCGTCGCGTACCGCCTGGCTTAAC
CGCGGCAGCGATTTGTTCGAACATCCTAAAGAGCACCGGGTCAGCGGCATTGAAGGCTGG
TTTGGTGCTGCCGGCCAACGCCCGCCGCGCTGGAAACAGGCCGTGGCGATCTGGCTGGCG
TTTTTTCCGGTGTCGCTGATATTCAACTTTGCCCTCGGCCCGCTGCTCGCTGAGCTGAGC
CTGTTGCCGCGCATCTTGATCGGCACGGCGTGCCTGACGCCGCTGATGGTGTATTTCTTC
ATCCCGTTGTCGACGCGTCTGCTGGCGAACTGGTTGAACAGCACGCCGACGAGGCCATTG
GCTGGCGCACCGTCGGCGCAGAATCGCTGA