METABLE2 Genes

PROKKA_00074 Pseudomonas

GenomePseudomonas ctg_1:72861-73466
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00074 hypothetical protein
ATGCAGCGCGACGCCCTCCTCACCCAGGACGAGCTGGATTTCATCCAGACAATGCAGCAC
AACCCGCAACTGAACGTGCGGGATGCGACGTCGAGTCTGCTGGTTAATGGTGGTTCGCAG
ATCCGTGACCTGCTGACACGTCTGGCTGCTCACGAGCAGGTGACGATCCAGGCCAACTTC
GAAAATCAACAGATGACTTTCCCGCTGCATCTGGTGGAAGACGAGTTCCACGCGCTGCAT
CTGCGTCTCGGGGTGCCGAGCATCTACGAAGACGGGCCGATGGTGCGCCCATGGCGTCTC
GTACTCGAGGAGCCGGTGGCATTGGAAAACGCCAAAGGCCAGCCCGGCACGCTGTGGGTG
CACGAGGTGTCGCACAAAGGTGTGTTGCTGGAAGTGCGCAACAAGACCAAACCACCGAAA
CATTTCGCCCTGTGGTTCAGCCCTTCCGGTTATGAGCGCATCTCGTTGCGCGGCCATTTC
GAGCGTGAAACCGAGCAAGGTTTCTTCGCTTACGAACTGAGCCAGACCGATGCCGACGAA
ACCGAGCGCCTGCGCCAGTTCATCCTTCAACAGCATCGCCTGACCCATCCCGCCCTGCAC
GCCTGA