METABLE2 Genes

PROKKA_00080 Pseudomonas

GenomePseudomonas ctg_1:78043-79836
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00080 hypothetical protein
ATGACAAAAACAACAATGCGCGCCATCTTCACACCGCAGGCGCTGGCCGCTGCGGTGGCT
CTGGGTTGCTGCGCCCAGGCGCACGCGGTCGCCTTCAACATCGGCGAAATCGAAGGCACC
TTCGACTCGTCACTTTCGGTCGGCGCGAGCTGGGGCCTGCGCGATGCCGACAACTCGCTG
GTCGGCACGGTCAATGGCGGCAGCGGACAATCGTCCACCGGTGATGACGGGCGCCTGAAT
TTCAAGAAGGGCGAAACCTTTTCGAAGATCTTCAAGGGCATCCATGACCTCGAACTGAAG
TACGGCGATACCGGCGTGTTCGTGCGGGGCAAATACTGGTACGACTTCGAACTCAAGGAC
GAAGACCGCGAGTTCAAACAGATCAGCGACAGCGGCCGCAAGGAAGGCGCCAAGTCTTCC
GGCGCGCAGATCCTCGATGCCTTCGTCTATCACAACTACGCCATCGCCGATTTGCCGGGC
ACCGTGCGGGCCGGCAAGCAGGTGGTGAGCTGGGGTGAAAGTACCTTCATCGGCAACTCG
ATCAACAGCATCAACCCGGTCGACGTCTCGGCGTTCCGCCGTCCCGGTGCCGAGATCAAG
GAAGGCCTGATTCCGGTGAACATGCTGTTTGGCTCGCAGAGCCTGACCGACAAACTCTCG
GTCGAAGGCTTCTACCAACTGGAGTGGGACCAGACCGTTCTCGACAACTGCGGCACGTTC
TTCGGCGTCGACGTGGCGGCGGACGGTTGCAACAACGGCTACACCGTCGGCAGCCCAGCG
GTGGCGCCACTGGTGCCGCTGACCACCGCGTTCGGCCAAGGCATCCAGGTCACCCGCGAG
GGCGTGGTGATCCCCCGTGGCGGCGATCGTGATGCGCGCGATTCCGGGCAGTGGGGCACG
GCGCTGCGCTGGCTCGGCGACGACACCGAGTACGGCCTCTACTTCATGAACTACCACAGC
CGTACGCCGACGGTCGGCACCACCACGGCAGGGCTGTCGACACTGGCGGCGTTGCCAGGC
ATGGTCGGCATTGCCAACGGACTCGCGCCCGGCAGTGGTGCGGGGCTGGCGCAAAGCGTG
ATGCTCGGGCGCGGGCAGTATTACCTCGAATACCCGGAAGACATTCGTCTGTACGGCGCC
AGCTTCTCCACCACTCTTCCGACGGGCACCGCATGGACCGGCGAGATCAGCTACCGGCCG
AACGCGCCGGTGCAGGTCAACACCAACGACCTGACCCTGGCACTGGTCAACCCGATTGCC
GGCGGCACCGCATCGCCACTCGCCACTTCGCCGGGTGCCGACAACAAAGGCTACCGGCGC
AAGGAAGTCACGCAAATCCAGAGCACCCTCACGCACTTCTTCGATCAGGTGCTCGGCGCC
GAACGCCTGACCGTGGTCGGCGAAGCAGCGGTGGTGCATGTCGGTGGTCTGGAGTCACGC
AGTGAGCTGCGTTATGGCCGTGATTCGGTCTACGGCCAGTACGGTTTCGGCGGCGACACC
GACGGTTTCGTCACCTCGACCTCGTGGGGCTATCGCGCCCGGGCGATTCTCGATTACGCC
AACGTCATCGGCGGGATCAACCTCAAGCCCAACCTGTCGTGGTCGCACGACGTCGCCGGT
TACGGCCCCAACGGACTGTTCAACGAAGGTGCGAAAGCCATCAGCTTCGGCGTCGATGCC
GACTACCGCAACACCTACACCGCGAGCCTGAGTTACACCGACTTTTTCGGTGGCGACTAC
AACGTCCTCGAAGACCGTGACTTCGTGGCCCTGAGCTTCGGCGTGAACTTCTGA