METABLE2 Genes

PROKKA_00082 Pseudomonas

GenomePseudomonas ctg_1:81131-81226
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00082 hypothetical protein
ATGAAGAACGAAGAGAAGCACAGCTTCGAATTCGGTTTTGAAGCCAAGGCTGCCGATTAC
ACACCTTCGGCCCTGCGCGCCGAGGGCGTGCGCTAA