METABLE2 Genes

PROKKA_00087 Pseudomonas

GenomePseudomonas ctg_1:89812-91116
ProductCDS Ureidoglycolate lyase
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:Q39BA7
Sequence
>PROKKA_00087 Ureidoglycolate lyase
ATGACACAGAATTCCATCCCCCGCAGCTGGGTCGCTTCGGCCAACGGTCACAGCGATTTC
CCCTTGCAGAATCTGCCGCTGGGCGTGTTCAGCCTGGACGGTTCGGCGCCTCGCGCGGGC
GTAGCGATCGGCGAGCACATTTTCGATTTGCAGGTGGCGCTTGAGGCCGGTCTGTTCGAC
GGTGTCGCACGCAGTGCGGTGGAAGCCATGCACGGCGGGCAGTTGAACGCGTTCTTTGAA
CTTGGCCGTGAGGCGCGGGTGGCCCTGCGCGAACGCCTGATCGAACTGTTCAGTGAAGGC
AGTACCCTGCGCGGCAACATCGAAGCGCAAGGCGCGAAACTCTTGCCGTTGGCTGCCGAT
TGCCAGATGCACCTGCCGGCACGGATCAGCGATTACACCGACTTCTACGTCGGCATCGAG
CACGCGCAGAACGTCGGCAAACTGTTCCGCCCGGATAACCCGCTGCTGCCGAACTACAAG
CACGTGCCGATCGGTTACCACGGTCGCGCTTCGACGGTGCGAGCGTCCGGCACCGACGTG
CGCCGGCCGAAAGGCCAGACGCTGCCGGCCGGGCAGACCGAACCGGTATTCGGTCCATGC
GCGCGTCTGGATTACGAACTGGAACTGGGCATCTGGATCGGTCAGGGCAATGAGATGGGC
GAGCCGATTGCCATCGGTGACGCCGCCGAGCACATCGCCGGGTTCTGCCTGCTCAACGAC
TGGTCGGCGCGGGATATCCAGGCTTGGGAATACCAGCCACTCGGCCCATTCCTGTCGAAG
AGTTTCATCACCAGCGTCTCGCCCTGGGTGGTAACGGCCGAAGCGCTGGAGCCTTTCCGT
ACTGCACAACCGGCGCGCCCTGAAGGTGATCCGCAGCCGCTGCCGTATCTGCTCGACAAG
CGCGATCAGGATGGCGGCGCCTTCGACATCGAGCTGGAAGTGCTGTTGCGTACCGAAACC
ATGCGCGAGCAGAACCTGCCCGCCCATCGTTTGACCCTGAGCAACACTCGTTACATGTAC
TGGACCGTGGCGCAAATGGTCGCGCACCACAGCGTCAACGGCTGCCAGTTGCAGGCCGGT
GACCTGTTCGGTTCGGGCACTTTGTCCGGCCCGGAAAACGGCCAGTTCGGCAGCCTGCTG
GAGATTACCGAGGGCGGTAAGAAACCGATCGAACTGGCTTCCGGCGAAGTGCGCAAATTC
CTTGAGGACGGTGACGAAATCATCCTGCGTGCCCGCTGCGCCCGCGACGGTTTTGCCTCG
ATCGGCTTCGGCGAATGTCGCGGCACCGTGATCGCTGCGCGCTGA