METABLE2 Genes

PROKKA_00089 Pseudomonas

GenomePseudomonas ctg_1:91856-92659
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK10941
Sequence
>PROKKA_00089 hypothetical protein
ATGAGTGCGCGCCAACGCTTTTTCGAATGCCTGCATCGTTCACCGCCAGCCCTGCTGGAA
GCTGCGCTGTGGATAAGTGCCGAGCACGACAAAACCCTCGAGCCCGAGGCATGGTTGCGC
ACCTTCAAGGATCTGCAACTACGCGTCAGCTATGGGCTGCCGATGCTGCCGGTCAGCGAA
CTGGCGCAACCGCTGTTGCGGCGCATGGTCGATCTCGGTTTCGCGCAGGATGATTTCCTG
CCGCTGCGCCCACAGGCGGCGCTGTTGCATCGCGTGTTGCACACCCAACGCGGTCAGCCG
TTGGCATTGGCGTTGATCGCACTGGAACTGGCGCGTGGGCTGGAGATTCCTCTGGTCGGG
GTCAACTTCCCCGGACATTTTCTGCTGCGGGTACCCGGCGCCGACCACTTGCTCGACCCT
TGCGGCGGGCGGCGACTGTATCCCAATGACTGCCGAGAACTGTTGCAACGCCAATACGGG
CCGAACATGCAGCTCAGCGCCGAACATTTGCTGAGCGCAACGCCGGTGCAGATGCTGCAA
CGTCTGTCACGCAACCTGCGCCAATTGCACCTGACCCACGACGATCACATCGCCGCGCTG
ATCGACGCAGAACGAGTGCTCGAACTGGGCGATGCGAAGGCCTCCGATTACATGGCCCGG
GCCAGTCTGTATCAACGGCTGGATTGCCCGAACGCTGAACGCTTCGATCTGGAGCATGCA
TTATTGCTCAGCGAAGACCCGATCCAGCGCCTGCGCCTGACCGAACGCCTCGGCCATCTG
TCGCCCAACTCCGTCGTGCATTGA