METABLE2 Genes

PROKKA_00091 Pseudomonas

GenomePseudomonas ctg_1:93938-94273
ProductCDS DNA damage-inducible protein YebG
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK10061
Sequence
>PROKKA_00091 DNA damage-inducible protein YebG
ATGGCCGTCGAAGTGGTATACCGCAGCAGCCGAGATCTGGAGCGCTTGTTCATGGATAAA
GCCGAAGCTGATCGTCATGACAAAATGCTCGAACTGGCCGAATATCTGGCCGATGTGCTG
CAAAAAGCCGTTCCGTCTCTGACCGAACAGCAAGTGGAAGAAGCCGGGATCTACATGGCG
AAGAATCGTGATGTGTTCGCCCGGGCGTTCAAGAGCCAGCCCGATGCGCTGTCGGAGCTG
ATCAATGCGCCGGCCGAGCCTGTCGAAAAAGCTGAAGCGGCAGAACCTGATGAGGCGCCG
GCGAAGCCAGCCAAAGCAGCGAAAGCGCCGAAGTAA